target-agnostic
pretraining sequences
Protein-conditioned nucleic-acid generation
Turn selection dynamics into design hypotheses.
Follow AptGEN from early-round SELEX counts through enrichment-aware learning, multi-scale protein conditioning, and candidate triage—entirely on your machine.
AGGAAGAATGCAGATTCCCAATAGCG
QC 91
protein targets in
the reported SFT corpus
target-associated
SELEX sequences
protein context scales:
global, residue, surface
One system · two routes
From selection history to new-target design
Historical SELEX teaches the model what selection looks like. At design time, a new target can enter through protein features alone—without same-target SELEX.
Historical input
Measure how every sequence changes across rounds.
AptGEN starts from a sequence × round count matrix. Counts are normalized per round before enrichment is interpreted, so deeper sequencing alone is not mistaken for selection.
- Input
- FASTQ-derived counts or CSV
- Output
- Normalized round trajectories
- Guardrail
- Counts are not affinity measurements
Interactive lab
Inspect real round dynamics. Explore real model outputs.
Local data boundaryYour file is parsed in this browser tab and is never uploaded.
Awaiting a round-count matrix
Load the bundled BRK example or inspect your own experiment.
We will calculate per-round frequencies, diversity, fold change, and enrichment trajectories locally.
DATASET
BRK repository demo
Parsed locally
TOP SEQUENCES
Selection trajectories
POPULATION
Diversity across rounds
SELECTION SHIFT
Final abundance vs enrichment
RANKED OUTPUT
Enrichment candidates
| Rank | Sequence | Start freq. | Final freq. | log₂ change | Trajectory |
|---|
Interpretation boundary: frequencies are normalized within the supplied rows; the bundled demo is an enrichment-ranked excerpt, not a complete round. Enrichment is a selection-derived proxy, and PCR bias or non-binding effects can also change counts.
CANDIDATE SET
BRK / snapshot
Versioned local model output
SEQUENCE SPACE
Composition map
VERSIONED METRICS
Snapshot context
- Model
- local DPO snapshot
- 5-mer F1
- —
- 6-mer F1
- —
- Mean edit distance
- —
These quantify recovery of an enriched sequence distribution. They do not establish binding affinity.
Candidate, not conclusion. Generated sequences require orthogonal filtering and experimental validation. QC priority is not predicted affinity, Kd, or proof of binding.
Inside the model
Protein context at three biological scales
The active MSAG route combines protein identity, residue context, and surface geometry before autoregressive sequence generation.
GLOBAL CONTEXT
What protein is this?
A mean-pooled protein language-model embedding supplies broad family and functional context, including for targets not present in the same-target training set.
- Captures
- identity · family · function
- Does not prove
- a physical binding interface
Read every output at the right level
A transparent evidence ladder
Computational confidence and distribution recovery are useful filters. Neither is a substitute for direct biochemical measurement.
SELEX selection dynamics
Directly observed sequencing counts and their normalized change across rounds.
- round frequency
- enrichment slope
- population diversity
Sequence-distribution recovery
How generated populations resemble held-out enriched sequence sets.
- k-mer F1 / JSD
- edit-distance recall
- validity / uniqueness
Structural plausibility
Predicted co-folds and confidence metrics can prioritize structural hypotheses.
- Boltz-2 confidence
- surface complementarity
- optional MD follow-up
Experimental binding
Direct wet-lab assays are required to establish binding, affinity, and specificity.
- SPR / BLI / MST
- EMSA / pull-down
- counter-target panel
Core interpretation rule
Enrichment, model reward, and structure confidence are different quantities.
The website never relabels a surrogate score as measured affinity. Bundled evidence is strongest within represented protein families; broad unseen-family generalization is not established. Advance candidates only when the corresponding experiment exists.
No external service required
Open the story.
Or load the model.
The static site includes a real BRK round-count excerpt and versioned local model outputs. The bundled Python server adds live MSAG sampling from repository weights and protein tensors.
index.html02 Standard-library local server03 Lazy checkpoint loading# From the AptGEN repository root
$ python website/server.py
AptGEN offline website: http://127.0.0.1:8000
Live inference: enabled
# Lightweight static-only mode
$ python website/server.py --no-live-inference